This real-time RT-PCR is a molecular tool for detection of Foot-and-mouth disease virus lineage O/ME-SA/SA-2018, as it is an emerging lineage in South Asia since 2018. The assay has been tested on 34 FMDV positive samples (including 12 SA-2018 samples) with a specificity of 91,7% (11/12 SA-2018 samples detected). The primers and probes are indicated hereafter, and the protocol is in the document attached: 

Oligo name (final concentration)       Sequence (5’-3’)                                                         Use

SA2018_F3 (0.4 μM)                              ACAACACCACCAATCCAAC                                         Forward Primer

SA2018_P3 (0.3 μM)                              FAM-ACTCACCCGACTTGCACTGCCGT-TAMRA        Probe

SA2018_Rev2 (0.4 μM)                          CGTTGTAAACAGTAGCCATGA                                    Reverse Primer

NB: This system has been validated on a small number of samples and should therefore be tested against other samples from this lineage.